Hairpin Loop

A hairpin loop in RNA is a sequence of nucleotides where a long segment of RNA can base-pair with each other, but a segment within that sequence can not base pair, causing a hairpin loop. An example of a 5' → 3' sequence of RNA which would lead to a hairpin loop structure is: GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC The above sequence is an example of dyad symmetry, where the bases downstream are complementary to the bases upstream and so they form base pairs. Hairpin loops are important in prokaryotic transcription termination. The hairpin loop forms during transcription and the structure causes the RNA polymerase to become dissociated from the DNA template strand. This process is known as rho-independent or intrinsic termination.

 

<< PreviousWord BrowserNext >>
dmitriy yazov
electric eclipse
abiocor
ascribed status
zx spectrum character set
ayaka komatsu
zong
pyword
beating a dead horse
cooloolidae
ainhumoid and mutilating keratodermia
ozzmosis
balassa samuelson effect
sylvia lynd
death watch
thorkelin
samuel dick
vermicious knids
military service of john kerry
hellmouth
microraptor
arnold (comic strip)
system
northern virginia community college
pierre chambon
the secret world of alex mack
wonderful radio london
international covenant on civil and cultural rights
uss kidd (ddg 993)
themiste
lvy process
uss chandler (ddg 996)
uss scott (ddg 995)
uss callaghan (ddg 994)
same sex marriage in saskatchewan
type in program
ontario provincial highway 404
denver dalley
inside woody allen
bratslav
edwin ward moore
jonha falls
patrick henry college
greg bailey